| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGUCACAGGAAGCUGCUUCGGGGGGUGAGCAAACUUUUUAAAAUGC… | 1536 nt | 0.4486 | |
| AGACGCUUCAGAGAUCCUCUGGAGGCCUGGGGGAGCUUUUGAGUACUUU… | 1700 nt | 0.4729 |
This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the CCRL2 was upregulated in common in blood leukocytes across three models of injury and inflammation (trauma/hemorrhage, burn, and LPS infusion) at a 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. In a separate study in porcine skin, the CCRL2 was found to be significantly increased in response to both sulfur mustard and thermal burn exposure at 7 days post-injury [Price et al. DOI:10.080/15569520903097754]. A study in mice demonstrated that the CCRL2 was part of a network of genes with decreased expression in juvenile CCI-injured peripheral whole blood compared to adult, indicating its involvement in the age-dependent peripheral immune transcriptomic profile following traumatic brain injury [Hazy et al. DOI:10.1038/s41598-019-45089-z]. In a rat model of polytrauma, local mRNA expression of the CCRL2 was significantly upregulated at the fracture site 24 hours post-trauma compared to osteotomy alone, associating it with the altered local immune response in severe combined injury [Mangum et al. DOI:10.1186/s13018-019-1082-4].