Basic Information

Symbol
CD3E
RNA class
mRNA
Alias
CD3 Epsilon Subunit Of T-Cell Receptor Complex T-Cell Surface Glycoprotein CD3 Epsilon Chain CD3-Epsilon CD3epsilon CD3e Antigen, Epsilon Polypeptide (TiT3 Complex) T-Cell Surface Antigen T3/Leu-4 Epsilon Chain CD3e Molecule, Epsilon (CD3-TCR Complex) T3E T-Cell Antigen Receptor Complex, Epsilon Subunit Of T3 CD3e Molecule CD3e Antigen IMD18 TCRE
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000733.4
Sequence length
1361.0 nt
GC content
0.5209

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-411.30 kcal/mol
Thermodynamic ensemble
Free energy: -437.79 kcal/mol
Frequency: 0.0000
Diversity: 360.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...................(((((..((((((((((((((.....)))))))).........((((....))))(((((((..((...(((..((((...((..((((((((..((((((((......))))...((((((((((..(...((((((((.(..(((((((((.......(((((((((.(((.((..(((((((..(..........(((...((..(((......)))..))...))).(((((((((((((((..(((.......(((((..................))))).....))).))))))...........(((((((((....)))).))))).((((((....))))))...(((((.(((((.((......((.((((.((.....)).)))).))........))..)))))...))))).))))))))).)..)))))))((((((.(((((((.(...(((((((.((((.((((..........)))).)))).))))))).(((((((((((.(.(.(((....)))).).))))))...(((..(((..((((((.((.(((((....((((..((((((((((((.(((((..(((((........((((.(((........(((((((.((.(((((...((((((...((((((((((((((((...((.((((..((.((.(((((......)))))...)).)))))).))....)))))))))))((((.....((..(((.....))).))...)))))))))))))))))))).)).......(((.(((........)))...))).))).))))....)))))))(((..........)))...)))))..)))))...))))))))))))..)))).....(((((((......((((....))))......))))))).......)))))))))))))))).)))....((.(((......))).)).....))))).(((....))).....).))))))).)))))))).))))))))).))).....))).)))))).))))(((((.......)))))........((((((((................)))))))))))))......)..).))))))))).)))).(..(((((...(((((.....)))))..)))))..).........................(((..(((....(((((.....................)))))....)))..)))...))))))))..))..))).)..)))...))..)))))))................)))))))))))...
Thermodynamic Ensemble Prediction
...................(((((.(((((,,((((((((.....))))))))....}))).((((....)))){{(({{{..{{...(({..{{{{...{{..((((((((,.((((((((....,,)}}}...((((((((({,.,{{{((((({((.(..{((((((((..{,...(((((((((.(((.((..,{{({((.{(..........(((...{,..(((......)))..,,...))).(((((((((((((((.,,((.......(((((..................))))).....))).)))))}...........(((((((((....))))}})))).((((({....})))))...{((((.(((((.{{,.{,.,({.((((.((.....)).)))).}},}...,,})}..}))))...))))}.))))))))).}.})))))),((((((.(((((((.(...(((((((.((((.((((..........)))).)))).))))))).((((((,,(((((((..(({..{{{{{{|,|||||,...{({,{(((,.((((,..|}}|{{{,...{((((,,((({(({(((((.((((,..((((({.......(((({((,....,,{{({{{,....{{{{{{{...,{{(({...||{{,(((((((((((...((.((((..((.((.(((((......)))))...)).)))))).)).,..)))))))))))||||}..}}}}}}},|}}}}}.,|,||,..,||,||||,||||}}}}}},,})..,}}}.|||,{||....,{|{,||,,.|,..,)),)}}},,}}))),,)),}}}.}....}},)))},})),}}..})))),.,))|||||}}})),,)}}}......||||((((((..........))))),....)))))))...}}}.,,,)))),))),,))))))..,,,((,({{.....,))},)}....,|,,||.,,,....))}.,...}.))))))).)))))))),)),)))))).))).,,..))),))))}).}))|(((((.......))))),.......((((((((................))))))))}))}}}}}}..}..).))))))))).)))).{..(((((...(((((.....)))))..)))))..}......................,,,,{{.,,...,..(((((.....................))))).....)),,))},..||))})))..))..))).),,)}},{.}}..)}})))},,,...........,,}))))))))))...

Transcripts

ID Sequence Length GC content
AGAAACCCUCCUCCCCUCCCAGCCUCAGGUGCCUGCUUCAGAAAAUGAA… 1361 nt 0.5209
Summary

The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CD3E is a well-known T cell marker, but many T cells exhibited low or no transcription activity for this gene, showing heterogeneity [Liu et al. DOI:10.1371/journal.pone.0318151]. Another human single-cell transcriptomic study of the corpus cavernosum identified the CD3E as a gene marker highly expressed in the T cell cluster [Zhao et al. DOI:10.1038/s41467-022-31950-9].