| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAACCCUCCUCCCCUCCCAGCCUCAGGUGCCUGCUUCAGAAAAUGAA… | 1361 nt | 0.5209 |
The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CD3E is a well-known T cell marker, but many T cells exhibited low or no transcription activity for this gene, showing heterogeneity [Liu et al. DOI:10.1371/journal.pone.0318151]. Another human single-cell transcriptomic study of the corpus cavernosum identified the CD3E as a gene marker highly expressed in the T cell cluster [Zhao et al. DOI:10.1038/s41467-022-31950-9].