| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUUCUAGCCAGGCUCUCAACUGUCUCCUGCGUUGCUGGGAAGUUCU… | 1486 nt | 0.5074 | |
| CUUUUUCUAGCCAGGCUCUCAACUGUCUCCUGCGUUGCUGGGAAGUUCU… | 1097 nt | 0.4403 |
This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
A study in mice demonstrated that the CD48 was stably expressed at 2 days post-injury but significantly upregulated at 14 and 60 days following controlled cortical impact, identifying it as part of the microglial sensome and a component of a specialized inflammatory state that emerges during the subacute and chronic phases of traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307].