Basic Information

Symbol
CDC6
RNA class
mRNA
Alias
Cell Division Cycle 6 CDC18L Cell Division Control Protein 6 Homolog Cdc18-Related Protein CDC6-Related Protein P62(Cdc6) HsCDC6 CDC6 (Cell Division Cycle 6, S. Cerevisiae) Homolog CDC6 Cell Division Cycle 6 Homolog (S. Cerevisiae) Cell Division Cycle 6 Homolog (S. Cerevisiae) CDC6 Cell Division Cycle 6 Homolog Cell Division Cycle 6 Homolog HsCDC18 HsCdc18 MGORS5
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001254.4
Sequence length
4564.0 nt
GC content
0.4479

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1413.60 kcal/mol
Thermodynamic ensemble
Free energy: -1502.06 kcal/mol
Frequency: 0.0000
Diversity: 1003.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((..(((.((((((((.(...((((.((((((((((((.(((.(((...))).))).)))....)))))))))))))...)))).))))).)))..))..(((.(..(((((..(((((.((((((........((.((((.(((((((((((((((((..((((((((((((((..(((..(((((.((........)).)))))..)))..))).))))..))))))).....))))))))))(((((.(((...((((((((......))))))))....(((((((........(((.......((....))......)))........))))))).....))).))))).))))))).))))...)))))))))))))...)))))..).)))((((.(((.((((..((.((((((((((((((...(((((......(((((..((((((((.((((((((...((....))...)))....(((.....((((.(((((..((...(((((((((((..((((....((((((...(((..((((((((......)))))..............(((((((((((..((.....((...(((...........))).....))....)).)))))))))))..)))...)))..)))))).....((((((......))))))((((((.......))))))........((((((........))))))...((((((((((((((((((((.((((((((((...))))))((((.((((((((((((..........(((((((((..(((((((((.((..(((((((((..................)))).)))))..)))))...)))))).....))))))))).........((((......))))(((((((.(((.((((((((.((((.((((((((...((((.((((..(((..(((((((((.(((....(.(.((((((((....((.((((((...((......)).......((((((((.((((.(((..(.((.(.((((..((..((((((..((((...((((((((((((.((((.(((.(((((((((....((((((((((..((((((.........))))))......))))..((((((((....((((((...(((((((((((......(((((((((.(((((((........(((((.((((((.((((((((......((((.....(((((((((............((((..((((....)))))))).((((((.((((...((((.((((((((((((((.((.(.((.(((((((((.((((......(((....)))....))))..)))).))))).))).))..)))).))))))))...))..))))...)))).))....)))).....)))))))))......((((.(((((((((((((........))))).((((...............)))).....)))))))).)))))))).((((.(((((((((((....(((((((((((((.........(((((....))))))))))...))))))))...))))((((((((....))))...)))).))))))).)))))))))))).......((..((((......)))).)).))))))..)))))(((((.....)))))...((((((((...(((((((((((((((...))))))))......((....(((((((..((((((.((.((..(.(.(((((((((((...((((((((.........((((......))))..........))))))))))))))))))).)).)).)).)).))))......)))))))....))..((((((.(((....(((((.((..(((.........)))..)).)))))....)))...)))))))))))))))))))))....))))))))))))))))...))))))).))))..)))))).....)))))))).(((......)))..((((((..(((((((((....)))))))....))..))))))..........))))))...(((((((((..(.(((((((..(((......)))....)).))))).)..)).)))))))...)))))))))..))).)))).))))...((((((.(((........))).)))))).........))))))))....))))....))))))..))...)))).).)).)..)))....))).).)))))))))).)).)).))....)))))))).).)....))))))))).)))))).)))).)))))))))))).))))(((((........)))))..(((((...........))))).(((.((((((((.((((.(((.....)))))))...)))).))))...))).....(((((((((.((((.((((((........)))).....(((.(((((......)))))))).(((((((.(((....))).))))))).....)).))))...............((((.....(.((((....(((....)))..)))).).....)))).(((((((.....)))))))(((((....)))))....))).)))))).(((((....)))))......((((((...)))))))))))))).))))))))))((((.((((.......)))).)))))))))))).)))).....(((((...((((((((((((..((.((..............((((((..((((((....)))))).))))))............(((....)))..(((((((((((((((((..((((((((((((((.....(((((((........)))))))...)).))))))))))...........(((((((....((((((((((.(((......)))))))).....(((((((((((((((((...((.(((...))).))......)))).)))).)))))))))(((((((((.....(((((((((.(.((((((((((((((((((...)))))))))).((((((((.((.((((((..........))))))..)).))..)))))).....(.((((....)))).).........(((((((.((((.............(((((((....(((...(.((((...(.(((((((((((.((((((((........(((((((((..(((((((..((.......))...))))))....)..))))).))))......(((((.((((((.......(((..((((........)))))))))))))..)))))))))))..))..))))).)))))).)...)))).)...)))...)))))))..)))).)))))))(((.((((((((...((((.(((.........))).)))).))))).))).))).)))))))).).))))))))).((((.((......))))))....((((((.(.((...)).).))))))..))))))))).....((((....))))....)))))..)))))))..))..)))))))))))..)))))).)).))..))))))..))))))..)))))...........((((((.(((((((((.((((((.(((((.....)))))))))))...((((((((((...((.....))....)))))))))).(((..((((((.....)).))))..)))((((((((.......)))))..))).(((((.(........).))))).(((((((((.......)))))))))...)))))))))...)))))))))))))).))))(((((.......))))).(((....(((((............)))))..)))))))))))).)))))))...((((((...))))))))))..)))).)))))))...))...))))))))).....)))...)))))..))).)))))((.((((((((((((((((..((((((((..((.((((((.......))).))).))..))).)).)))))))..(((((.((((.(((....))))))).)))))((((......))))..)))))))))))).))..(((((....)))))((.(((((((...........))))))).))(((((((((...)))))))))..))))).)))))....))))))..((((.(((((((((((((((((((((.((((((((..........(((((((......))))))))))))))))))))))).))).((........))(((..(((((.......)))))..)))))))))))))..)))).........(((((((.....)))))))...)))))))).)))))).))).)...(((.(((.((((......)))).))))))...))).
Thermodynamic Ensemble Prediction
...((..(((.(((({{(({(,,(((((.{({(((((,(((.(((.(({...})).))).)))..,,))))}}))})))},,.}))),))))).}})..))..(({.(..(((((..(((({{((((((........((.((((.(((((((((((((((((.,((((((((((((((..(((..(((((,({,....,.,)}.)))))..)))..))).))))..))))))).....))))))))))(((((.(((...(((((((({.....))))))))....(((((((........((,........{,{..,,....,,)))........))))))).....))).))))).))))))).))))...)))))))))))))...)))))..).))){(({,{((.{{{{,,((.((((((((((((((...(((((......(((((..(((({(((.((((((((...((....}}...}}}....,,,.....((((.(((((..((...(((((((((((..((({....((((((...(((..{({(((((......)))))..............(((((((((((..{,....,{{..,{{{,.........,}}),..,.....,.),.)))))))))))..}))...))),.)))))).....((((((......))))))((((((.......))))))........((((((........))))))...((((((((((((((((((((.{{{.((((((...)))))|((((.((((((((((((......,...(((((((((.,(((((((((.((..{((((((((.....,.....,.,,...)))).))))}..}))))...))))))....,))))))))).........((((......))))(((((((.(((.((((((((,((((.((((((((...((((.((((..{((..(((((((((.(((.,...(({((((((((,...,{,{{{,,,...,{,{((((({.,,,,,.(((((((((.{{(((((..{(((,(((({,..,({|(({{,{|,||,,{{{{.(((({,,,{||{(({,({(.(((((((((,,,.{({{{{{{{{.,||{,{{||,......})))))}}},..))))..((((((((....((((((...(((((((((((......(((((((((.(((((((........(((((.((((((.((((((((......((((.....(((((((((......,,{{,.{{{{..{{{,....,}}},|||,(((,...,,|||||||,..{{({((((....,,.|}||||..|||,.({((((((.{{{{{{{,{|.|.{|{||,,{|||..,,,)}})))).))).}.}}.))))}}),)))))).},,.,|||....,}}.)))...)))}.....)))))))))......((((.(((((((((((((........))))).{(((...,,......,,..)))}.....)))))))).)))))))).((((.(((((((((((,{..((((((((((((({,.|{{{..{{{{{....))))))))))...))))))))..|)))){(({({{{....}})}..,)))).))))))).)))))))))))).......((..((((......)))).)).))))))..)))))(((((.....))))).,.((((((((...(((((((((((((((...))))))))......((....(((((((..((((.,{,({({..(.(.((((((((((({,.{(((((((.........((((......))))..........))))))))))))))))))).)}.}},)).),.))))......)))))))....}}..((((((.((,....{{,(({((,.{((((,......}})),.},},)))}}}.,},,}.)))))))))))))))))))))..,.))))))))))))))))...))))))),,)))..)))))).....)))))))).{{{......}},..((((((..(({((((((....}}}))))}...})..))))))........,,||}}||...(((((((((..(.((((({,{{{((......}}).},.)).))))).)..)).)))))))..,)))))))))..}}),)))))}))))}}||||}},}|}}))),.}})))}))),})})}))))}})}|))}}}}}},,,((((((((((,(({((.({{,,...})).)).)))....))))))}})))||||..,..,)))}....)))))))),)})...,))))))))).)))))).)))).)))))))))))).))))|((((........))))}..(((((...........)))))...(((({({,...,)).))))(((((((.{((,{..{{,{,{,{{,...})}}).}.}}.}.))).)))))))((((........)))).....(((.(((((......)))))))).{((((((.(((,...})),))))))}...,.||||................}}}}...{((((((..,{,.((((.((........))..)))){(({..(((((((.....)))))))..}))}.,{{,{({{{..|||||....}}}}|.}}}}}}))}))))))}{(((((...)))))})))))))).))))))))))((((.((((.......)))).))))}))))))),}))),,,,.,,,||...((((((((((((.,{({(({{,,,..{{{....((((((..((((((....)))))).))))))..}}},.,,,..(((....)))..(((((((((((((((((..((((((((((((((.{...{((((((........)))))))..})))))))))))))...........(((((((....((({((((((.(({......)))))})).....(((((((((((((({((,{{({,((,...}}}.},...,,,})))})))).)))))))))(((((((((.....(((((((((.(.(((((((((((,(({{{(.{{||||}}|||({((((((,(((,,{((,,,...,,....,||||,,..||{||.||},,||({...,.{{((..,,|}||.,...,...,.|||{|||.,{|{,.,}}}...}}.}||{|||,.}}}|||}}.}}||||}}}{.(((((((((((.(((((((({.......(((((((((..(((((((..((.......))...))))))....)..))))).))))......,((((,(((((({{.....({{,.,{{.......,,})))))}})))))..)))})))))))..))..))))).)))))).},,.,},,.},..}))|,,}}}}}||{||||}.})))}}}{{(,{({{{{{{,..{{|{.|{{,.,..,,,,))).)))),))}}),})),))}.}))))))).).))))))))).((((.((......))))))....((((((.{.{{...,}.}.))))))..))))))))).....((((....))))....}))))..)))))))..))..)))))))))))..)))))).))}}},})))))}..))))))..||||,.....,.....((((((.(((((((((.((((({.(((((.....)))))})))))...((((((((((...((.....))....)))))))))).(((..((((((.....)).))))..)))((((((((.......)))))..))).(((((.(........).))))).{((((((((.......))))))))}...)))))))))...))))))))))||||,,,,)||||,..,,,,.,}})).|||....(((((..,,.....,,.)))))}})))},)))))))))))))))...{((((.....,))))))))..))))}}))))))...))...))))))))),,...}}}...}})))..))).})))|((.((((((((((((((((..(({(((((,,{{.{{|||||,....}))}.}||,|||,|},.,},))}))))),,((((.((((.(((....))))))).))))|((((......))))}.)))))))))))).)),..((((....))))|{{.(((((((,.......,..))))))}.}}(((((((((...)))))))))..))))).)))))....))))))..((({.((((((((({{({((((((((.(((((((({...,..,,,({(({{{..,,,,))))}}))))))))))))))))).})},{{,.,,....}}|||..{{(({,.,,,..)})))..))}))))))))))..)))),||,,,...(((((((.....)))))))...)))))}}),)))))),))),)...((({(((.((((......)))),))))))..,))}.

Transcripts

ID Sequence Length GC content
AUUCGGAUUUGGCGCGAGCGCGGCUGGAGUUUGCUGCUGCCGCUGUGCA… 4564 nt 0.4479
Summary

The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Cdc6, a protein essential for the initiation of DNA replication. This protein functions as a regulator at the early steps of DNA replication. It localizes in cell nucleus during cell cyle G1, but translocates to the cytoplasm at the start of S phase. The subcellular translocation of this protein during cell cyle is regulated through its phosphorylation by Cdks. Transcription of this protein was reported to be regulated in response to mitogenic signals through transcriptional control mechanism involving E2F proteins. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CDC6 is specifically upregulated in the early stages of myocardial infarction, peaking between 48 hours and one week post-infarction before returning to baseline by eight weeks [Wen et al. DOI:10.1038/s41598-025-94988-x].