Basic Information

Symbol
CDH5
RNA class
mRNA
Alias
Cadherin 5 VE-Cadherin CD144 7B4 Cadherin 5, Type 2, VE-Cadherin (Vascular Epithelium) Cadherin 5, Type 2 (Vascular Endothelium) Vascular Endothelial Cadherin 7B4 Antigen Cadherin-5 Endothelial-Specific Cadherin Cd144 Antigen CD144 Antigen
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001795.5
Sequence length
4057.0 nt
GC content
0.5465

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1467.20 kcal/mol
Thermodynamic ensemble
Free energy: -1541.06 kcal/mol
Frequency: 0.0000
Diversity: 791.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((((((((.((((((.(((((((..((((((((........((.(((....)))..))))))))))...)))(((((((((..(((((.....(((((..((((((((.((((((((((...(((....)))...))))...((((..(((((((((......((((.....)))).........))))))))))))).....)))))).((((((((..((((((.((.......((((...((..((((.((........)).))))..))...))))((((.(((...)))..(((.....))).....))))(((.(((((((((.(........).))))).)))))))((((((.((.(((((((..((((((((.((((((.......)))((..((((((..((((((..(((......))).((((..((.((((((....((....(((.(((...((((((.....)))))).))).))).....((((((...))))))......(((((((((((((.((.((((((((..((((((((((.......((((..(((.((((((.(.((.(.(((((((((....)))).)))))).)).).))))))(((((....)))))(((((.(((.(........).))))))))............)))..)))).....))))))))))...)))))..)))...)).)))))........))))))))(((.((...((((((((((((((((((((((...((((((.((.((((.((((((((((((....(((((((((....((.((((....................))))))....)))).)))))......)))))))))).)).).))).)).)))).))((((.((((((((((...(((...))).)))).))))))))))...((....)).......)))))))))((........)).....)))))))))).)))..)).)))))..)))))).))((((........))))(((((((..((((((.........)))))).......))))))).....(((((.((((....(((.(((.((.((((((((..((((((((((.(((.....(((((..((((((.(((..(.((.((((.((((((..((((....((((((..((((................))))..)))))).........(((.......))).....(((((((((((((.(((.((.((((.((((..(((((((((.((...(((...((.((((((....((((((((((((((((((((......(((((..((((...)))).........(((((......))))))))))(((...)))))))).))))......)))))))).)))))))))...)).....)))..)).)))))..))))((.(((.(((((..(((((.....)))))..)))))....))).)))))).)))).)).))).....(((((......))))))))))))))))))..(((((....................))))).......((((...))))..((((((.......))))))..((((............))))((........))...(((((((((......((((......((((.(((..((((.((......))..)))).))).))))(((((((.(((((((.....))))))))).......))))).........))))....))))))))).....(((.....)))))))..))))))..)))).))))))))))))((((....))))((.((((((..(((.(((((..(((((((...((((.(((((..(.((...(((((((..(((((((((((..((((((((.(.((.(....).)).))))).))))(((((......))))))))))....)))))).)))))))....)).)..)))))..)))).)))))))..)))))..)))..((((.(((((((((((..((((((((((((((.(((......))))))))))..)))))))...(((((((((((.....(((.(((((((....(((.....)))..)))))))..)))...)))))).))))).((((((((((..((.((((((.(.....((.((.(.((........)).)..)).))..)))).))))).))))).)))))..(((((...(((((...))))).)))))((((......))))..))))))))))).)))).........((((((........)))...))).((((....))))......)))))).))..........)))))....)))))))))).)))..)))))).)).)).))))))...)))))))))((((........)))).)))).(((((((((((((.((((((((......(((((((.....(((((..........((...))...........((((((.((((.(((((((((((((((((((........)))..(((((((.......)))))))...((((((((.(((......)))..)))))))).....((((.((((.(((((..(((..(((..............)))...)))))))).)))))))).....(((((((.(((.(((....))))))(((((..((((((((.....)))))...)))))))))))))))..(((((((........))))))))))))))))))))))))))).))))))))))))))))))....)))))).).).)))))).((((((((((....)))))..)))))((((.((((((..(((...)))....)))))).))))(((((.((((((.((..(((((...(((((((......(((((.(((..((((..(((((((.((....))...)))))).)...)))).((((.(((((...))).)).))))((((((((((.....((((((.......))))))....(((((......))))).....))).))))))).....((((...........))))....(((....)))..))).))))))))))))....)))))....))...)))))).)))))...(((((.............)))))..)))))))....((((((..(((.....)))....)))))).(((((((((......))).).))))).))))))))))))..))))).))))))))...))))))).))))))))...))))))))..))))))))..((((((((......((.........))..)))))))).....))))))))............(((((...))))).......(((((....))))).))))).))))).))))))))).......))))))))).).)).)))))..))))..(((((((...((((((.....)))))).(((.((((((((...((((((....((..((((..((((..(.((...((((......))))...))..)..))))..))))..))..))))))..)))))))).)))................(((.((((((.((((((.......))).((((...)))).......((((.(((((((((((.(((.((((.(((..((((((((((((((((.((((((((((.(((..............((.(((....))).)).((((((.................))))))....))).))))).)))))))))))..)))))).)))).))).))))))).)))..........))))))))))))...................(((((........)))))......(((........)))......))).)))))))))....((((......)))).....((((((....)))))))))))))...
Thermodynamic Ensemble Prediction
......,.(((((((((((.((((({{(((((((..((((((((........(,.(((....)))..)}))))))))...)))(((((((((..(((((.....(((((..((((((((.((((((.(..((((,({((((,{...},))))}},(({{(((((,{(({....,(({{.....,))).....},,.)})))))))),,)))),.)))))).((((((((..(((((({((.,,,,,.,{{({{,{(((({{(,({........)).})))..}))))))).((({.,,,...|||..(({,,...}||..,..}}}}{((.(((((((((.{........}.)))))},)))))}((((((.((.(((((((..((((((((.((((((.......)))((..((((((,.,{{(({|,((({.....|||.,,((({((.{(((({.,..{{....(((.(((...((((((.....)))))).))).))).....((((((...)))))).....((((((((((((((.((.((((((((..((((((((((.{...,.((((..(((.((((((.(.((.(.(((((((((....)))).)))))).)).).)))))),((((....))))}(((((.(((.(........).))))))))..,,.....,..)))..))))....}))))))))))...)))))..)))...)).)))))........))))))))){{.{{...((((((((((((((((((((((..,((((((.((.(((,.((((((((((((....(((((((((....((.((((.......,............))))))....))))}}))))......))))))))))},).,.))).)).)))).))|(((.((((((((((...{{{...))).)))).)))))))))}...((....)).......)))))))))|({.......)).....)))))))))),,))..}}.,)}}}}.)))))}.}.((((........))))(((((((.,((((((.........)))))).......)))))))..,..(((((.((((....(((.(((.((.((((((((..((((((((((.(((...,.(((((,,(((((,,(((..,.((.((((.((((((..((((....{(((((..((((................))))..)))))}.{{{.,,..,,{}}}..,,))}.,...(((((((((((((.(((.((.((((.((((..(({(((({,.{({{,(((,,,(({(({((({{..((({{{{{{{{|||,,||||,.....{(((({,(,({,...,|,,,......,|{{{{......)))),)))))|||....))))}}},||||,.,,,.,,,}}))).})})))|||......|{{,|||...,.,))),.}))),.,.|||,(((((..(((((.....)))))..)))))....))},),)))).)))).}}.))).....(((((......))))))))))))))))))..((((({{........,,....,,..})))).......((((...})))..(((({,,{{{,..,)))))..||{{.......,....|}},,|}.....,,|,...(((((((({.....,{.((,..{{.((((.(((..((((.((......))..)))).))).)))}(((((((.(((((((.....)))))))}),.....}})))),....,..,}}))}..}))))))))),,..}|||.....)}.))))..))))))..)))).))|)))))))))((((....))))((.((((((..(((.(((((..(((((((.,.((((.(((((..(.((...(((((((..((((((((((({.((((((((,{,((.,...,),}},))))).)))}{((({......))))))))))....)))))).)))))))....)).)..))))),,)})).)))))))..))))),,|}}..((((.(((((((((((..{(((((((((((((.(((......))))))))))..)))))))...(((((((((((.....(((.(((((((....(((.....)))..))))))).,}))...))))))))}))),((((((((((..((.((((((.{.....((.((.{{({..,.....}||}..}},)).,}))).))))).))))).))))).,(((({.,.(((((...})))).}))))|||{,,,,,.)))}..))))))))))).)))).,...,}}.{{{(((........))),..|,,.((((....)))),,},..)))))).)),,,.}}....))))),..,))}))))))).)))..)))))).)).)).))))))...)))))))))((((........)))).}}}}}(((((((((((((..{((((((.,....(((((((.....(((((,,........{{...}}...........((((((.((((.(((((((((((((((((((........)))..(((((((.......)))))))...(((((((,.(((......)))..,)))))))....,((((.((((.(((({.{(((..||({{{...........})),,.)))))))).)))))))}.....{{(((({.(((.(((....))))))((((,.{((((((((.....)))))...)))))))))))))}}..(((((((........))))))))))))))))))))))))))).))))))))))))))))))...,)))))).}.,})))))).((((((((({....}))))..)))))((((.((((((..{({...}}}.,..)))))).))))(((((.((((((.({..(((((...(((((({.....{(((((.(((..((((..(((((((,,,....,....}))))).),..)))).((((.(((((...))).)).)))){(((((((((.....((((((.......))))))....(((((......))))).,...))).))))))}.....((((,........},))))....,,{....},,..))).)))))))))))).,..)))))....)}...)))))).)))))...(((((.............)))))..)))))))....(({{{{..,,{|,,.,}}}....)))))).{{{{|||||.....,))).}|,)))).}))}}}))))))..)}))).))))))))...))))))).)))))))),..))))))))..))))))))..{(((((((.,,{..{{.........))..)))))))}.....))))))))............(((((...))))).......(((((....))))).))))).))))).))))))))).......))))))))).).)).)))))..)))).,(((((((...((((((.....)))))).(((.((((((((...((((((,...{(..((((..(((({,..((...((((......))))...)).,)},))})..))))..))..))))))..)))))))).))).{........,,,...(((.((((((.(((((({,..,,.,,,.((((...)))).......((({{(((((((({{{.{((.((((.(((.,((({{(((((((((((.((((((((((.(((..........,,,.({.,((,,..,},{||{(,.{{{...,}}....}))}},,))}))}...,))).))))).))))))))))}..)))))),)),}.}}}.))))))}.}}},...,.....})))))))))))...............,,.{(((((........)))))}.,,.,({(.......,))}......))).)))))))))....((((......)))}.....((((((....)))))))))))))...

Transcripts

ID Sequence Length GC content
ACUCACGCUCAGCCCUGGACGGACAGGCAGUCCAACGGAACAGAAACAU… 4057 nt 0.5465
Summary

This gene encodes a classical cadherin of the cadherin superfamily. The encoded preproprotein is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion molecule is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Functioning as a classical cadherin by imparting to cells the ability to adhere in a homophilic manner, this protein plays a role in endothelial adherens junction assembly and maintenance. This gene is located in a gene cluster in a region on the long arm of chromosome 16 that is involved in loss of heterozygosity events in breast and prostate cancer. [provided by RefSeq, Nov 2015]

Forensic Context

A study in mice demonstrated that the CDH5 is a general marker for endothelial cells, being highly expressed in all endothelial cell clusters within brown adipose tissue, including capillary, arterial, and venous subtypes [Behrens et al. DOI:10.1016/j.molmet.2025.102252]. A review of single-cell sequencing in murine and human myocardial infarction models further established that the CDH5 is a highly expressed marker for endothelial cells across all identified cardiac endothelial cell clusters [Bian et al. DOI:10.3892/mmr.2025.13680]. A study in mice demonstrated that seawater drowning-induced acute lung injury downregulates VE-cadherin, a key endothelial adherens junction protein, contributing to pulmonary vascular hyperpermeability, and this reduction was restored by CDC42 overexpression, which alleviated injury and reduced permeability [Chen et al. DOI:10.1016/j.lfs.2025.124109]. In human sepsis, lipopolysaccharide-induced endothelial barrier disruption suppresses VE-cadherin expression in vitro, and knockdown of the upregulated circRNA hsa_circ_0074158 significantly enhanced VE-cadherin expression, partially reversing the increased endothelial permeability [Liao et al. DOI:10.3389/fgene.2022.1002344].