| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCAGAGUCUUAAAACCGAGGGCCCGCAGGGGUCCCCGCGGCCGCCGCG… | 1026 nt | 0.5692 | |
| GCCAGAGUCUUAAAACCGAGGGCCCGCAGGGGUCCCCGCGGCCGCCGCG… | 1122 nt | 0.5633 |
This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015] CIViC Summary for CDK5 Gene
A study in humans demonstrated that the CDK5 mRNA was upregulated in both acute emergency department patients and outpatient concussion clinic patients with mild traumatic brain injury compared to healthy controls, with a fold change greater than two [Cheng et al. DOI:10.1002/jcp.28139].