Basic Information

Symbol
CDKN2A
RNA class
mRNA
Alias
Cyclin Dependent Kinase Inhibitor 2A P14ARF CDK4I MTS1 ARF Cyclin-Dependent Kinase 4 Inhibitor A P16-INK4A P16INK4a P19Arf INK4a CDKN2 CMM2 INK4 CAI2 P16 P19 P14 MLM Cyclin-Dependent Kinase Inhibitor 2A (Melanoma, P16, Inhibits CDK4) Cyclin-Dependent Kinase Inhibitor 2A Multiple Tumour Suppressor 1 Multiple Tumor Suppressor 1 CDKN2A/ARF Intron 2 LncRNA Alternative Reading Frame Inhibitor Of Cdk4 A MTS-1 Cell Cycle Negative Regulator Beta P19 Alternate Open Reading Frame P14 Alternate Open Reading Frame CDK4 Inhibitor P16-INK4 Tumor Suppressor ARF P16-INK4a P16-INK4 P16INK4A P16INK4 TP16
Location (GRCh38)
9:21967752-21995301
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Other applications
External database
HGNC NCBI Ensembl OMIM UniProt UniProt GTEx

MANE select

Transcript ID
NM_000077.5
Sequence length
978.0 nt
GC content
0.5818

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-400.50 kcal/mol
Thermodynamic ensemble
Free energy: -418.91 kcal/mol
Frequency: 0.0000
Diversity: 180.88
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((.((((((.((((((..((((((.(..((.(((((((.((((..(((.((((((((.(((((((..((((.((.((.((((((((((((((((((((..((((.(((((((......)))).((((((((((((.((.((((........))))))..((((......)))).......))))))))))))(((((((((.....)))))))))..((((((((.......)))))))).))))))).)))).)))))))))((((((.((((((.((((((.....)))))).)).))..)).)))).))..))))))).)))).))))(((((.((.(........).)))))))((..((((.(((((((....))))))))))).))((((((....((.((((...((((((((((((((..((........))..))...)))))).....))))))..))))))....))))))(((((((...(((.((.....)).)))...))...)))))............)))))))))))))))((....)).)))...)))))))))))....))..).))(((((....((((((.....)))))))))))........(((((.(((........)))))))))))).)))))).......((((((....)))))).((.((((((((((............))))))))))))......))))))))))))(((((......)))))..((((((((((((..(((.((......((.((((....)))).))......)).))).)))))....)))))))((((((........))).)))....(((((...((((((((.(((........)))))))))))....)))))((((((.....)))))).......))))...................................
Thermodynamic Ensemble Prediction
,,(((,((((((.((((((.((((((..((((((.{..,(.(((((((.((((..(((.((((((((.((((((({(((((.({,((.(((((((((((((((({(((.,(({(,((({{((,,,...)))),((((((((((((.((.((((........))))))..((((......)))).......))))))))))))(((((((((.....)))))))))..((((((((.......)))))))).})))))}.)))),)))))))))((((((.{(((((,((((((,...,)))))).}}.)).,)),)))},)),}))))))).)))).))))||{{{.{(,(,{,,,,..|,||}}}},||},{{{{.(((((((....))))))))))),))((((((....((.((((.,.((((((((((((((..((........))..))...)))))).....)))))),.))))}),...))))))(((((,{...{{{.{(,,,,.}},))),.......)))))............}))))))))))))))((....}),))}...))))))))))).}..,},...,.(((((....((((((.....)))))))))))........((((,{(((........))))))))}))).)))))).......{{((({....}}}))}.,{.((((((((({.,...,,,,})})))))}}}}},,......)))))))))))).}||....,{{{,((({{(((((((({({(,..||.,|}.....((.((({....)))).)).....,{(({|...))))},.}))))))}((((((,......,))),,))....(((((.{,((((((((.(((........)))))))))))..,,)))))((((((.....))))))......,)))).,}}..,,,,......,,,,,..............

Transcripts

ID Sequence Length GC content
NM_000077.5 NCBI
GAGAGCAGGCAGCGGGCGGCGGGGAGCAGCAUGGAGCCGGCGGCGGGGA… 978 nt 0.5818
NM_001195132.2 NCBI
GAGAGCAGGCAGCGGGCGGCGGGGAGCAGCAUGGAGCCGGCGGCGGGGA… 1175 nt 0.5821
NM_001363763.2 NCBI
AGAUGCUCCGCGGCUGUCGUGAAGGUUAAAACCGAAAAUAAAAAUGGGC… 1302 nt 0.5545
NM_058195.4 NCBI
ACCUCUGGUGCCAAAGGGCGGCGCAGCGGCUGCCGAGCUCGGCCCUGGA… 1052 nt 0.5827
NM_058197.5 NCBI
GAGAGCAGGCAGCGGGCGGCGGGGAGCAGCAUGGAGCCGGCGGCGGGGA… 1252 nt 0.5767
Summary

This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012] CIViC Summary for CDKN2A Gene CDKN2A loss has been shown to be a significant event in a number of cancer types. While no targeted therapeutic has been engaged in clinical trials, the prognostic impact has been studied by a number of meta-analyses. In majority of cases CDKN2A is inactivated by homozygous deletions. One of the mechanisms by which loss of CDKN2A can occur is by hypermethylation of the promoter region for the gene. However, the prognostic impact of promoter hypermethylation has been relatively ambiguous. Many studies have suggesting poorer prognostic outcome for patients with hypermethylation in colorectal, liver, and younger lung cancer patients. This being said, there is still research to be done before this becomes a widely-accepted prognostic indicator. Additionally, CDKN2A (p16) expression is a surrogate marker for HPV infection. As such, CDKN2A expression is prognostic in Oropharyngeal and probably also non-oropharyngeal head and neck squamous cell carcinomas.

Forensic Context

A study in human ovarian cancer samples identified the CDKN2A as a tumor suppressor gene, with its promoter noted to be hypermethylated, and it was included in the DNA methylation dimension of a multi-dimensional module (md-module 119) that was part of the bladder cancer pathway [Zhang et al. DOI:10.1093/nar/gks725].