Basic Information

Symbol
CEBPD
RNA class
mRNA
Alias
CCAAT Enhancer Binding Protein Delta NF-IL6-Beta C/EBP-Delta CRP3 CELF CCAAT/Enhancer Binding Protein (C/EBP), Delta CCAAT/Enhancer-Binding Protein Delta Nuclear Factor NF-IL6-Beta C/EBP Delta CCAAT/Enhancer Binding Protein Delta
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Cause of death analysis

MANE select

Transcript ID
NM_005195.4
Sequence length
1252.0 nt
GC content
0.6597

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-563.00 kcal/mol
Thermodynamic ensemble
Free energy: -583.17 kcal/mol
Frequency: 0.0000
Diversity: 260.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((...((.((((((((.(((((.(((.((..((.((((((.....((((((.(((.((((...)))).))).)))))))))))))).)).))))))))..(((.((((.(((((.((...))..(((((((((...(((((((.((((((....(((.(((((.....(((((((.((((((((((.....((((((.....(((.(((.((((...........)))))).).)))....)))))).....(((((.((.(((((((((.....((.(((.((......)).))).)).)))))..)).)).)).)))))((((((((((((.((((....)))).)).))))))))))(((((((((((.((.((...((.((.....))..))....)).)).))))))..)))))..)))))..))))).)))))))((((((..(((((.((....)).))))).......((((((.((((((((((....((((..........))))..)))))).))))))))))))))))))))).)))....)))))))))))))))))))))).))))).)))).)))....((((((((.....)))..))))).....((.(..(((((.(..(((((............)))))..).)))))..)..)))))))))).))..((((((((((((((....(((((((.((((.(((........)))..)))).)))))))((((((......))))))((((((((((.(((((((((((((.((.......(((((((.((..(((.........))).)).))).))))))))))))))....(((((.((((((((((.(.(.(((.((..((..((................))..))..)).)))).)..))))))))))))).)).)).)))))))))).))))))))).))))))))....(((((((........)))....)))).......))))......((((.(((((((.....((((((((((((((((((.....(((((((((..(((.(((...((.((((..((....)).)))).))..))).)))..)))))))))(((((..........)))))..(((((...)))))........)))).))))))...))))))))....)))))))......(((((((((.....)))))))))...)))).............
Thermodynamic Ensemble Prediction
.((((...((.{(((((((.(((((.(((.((..((.((((((.....((((((.(((.((({...}))).))).)))))))))))))).)).))))))))..(((.((((.(((((.(........(((((((((...(((((({{((((((....(((.(((((....{(((((((.(((((((((({{,,,((((((...{.(((.(((.((((...........)))))).).))).,..)))))).,,,.{((((.((.((({(((((.....({,({(,{{...,,,)}.})).,,.)))))..)).)).)).))))}((((((((((((.((({....}))).)).))))))))))(((({{{((((.((,((...((.((.....}}..))....)).)).)))))}..)))))).)))))..))))).)))))))|(((((..(((((.((....)).))))).......((((((.((((((((((,,..((((.{......,.)))).,))))))},)))))))))))))),))))).)))....)))))))))))))))))))))).))))).)))).)))....((((((((.....)))..))))).....((.{..(((((.(..(((({.{.........})))))..).)))))..}..)))))))))).))..((((((((((((((....(((((((.((((.(((........)))..}))).)))))))((((({.,...,})))))((((((((({,((((((((((((({((.......(((((((.((,.(((......,..))).)).))).))))})))))))))....(((({{((((((((((.{.(.(((.((..((..((.............,..))..))..)).)))).}.}))})))))))))).)).}).)))))))))).))))))))||})))))))....{((((((........)))....)))},......)})),..,,.{{({,(((((((,,...((((((({{{{{{{{{{{.,,..{,{{{{{{|,,{{|,|{{|,,{{.{{((.,{{,.,,}|.|}|},}}..}})|}}}..|||}}}}}}{|||,..........}}}}|..|{{{|.,,}}})).,}},,,.)))),)))})),,.)))))})),},,))))))}......(((((((((,...,)))))))))...))}),,,,,........

Transcripts

ID Sequence Length GC content
AGGUGACAGCCUCGCUUGGACGCAGAGCCCGGCCCGACGCCGCCAUGAG… 1252 nt 0.6597
Summary

The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-alpha. The encoded protein is important in the regulation of genes involved in immune and inflammatory responses, and may be involved in the regulation of genes associated with activation and/or differentiation of macrophages. The cytogenetic location of this locus has been reported as both 8p11 and 8q11. [provided by RefSeq, Sep 2010]

Forensic Context

A study in human cadavers demonstrated that the CEBPD is upregulated in prostate tissue with a high postmortem interval, where it functions as a transcription factor indicative of active gene transcription even after death [Javan et al. DOI:10.1038/s41598-025-29561-7]. Separately, research in mice and humans identified the CEBPD as a novel disease gene that is upregulated in sepsis-induced myocardial dysfunction, with its differential expression validated by qRT-PCR and external datasets [Yao et al. DOI:10.1016/j.ygeno.2024.110911].