| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGUGACAGCCUCGCUUGGACGCAGAGCCCGGCCCGACGCCGCCAUGAG… | 1252 nt | 0.6597 |
The protein encoded by this intronless gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-alpha. The encoded protein is important in the regulation of genes involved in immune and inflammatory responses, and may be involved in the regulation of genes associated with activation and/or differentiation of macrophages. The cytogenetic location of this locus has been reported as both 8p11 and 8q11. [provided by RefSeq, Sep 2010]
A study in human cadavers demonstrated that the CEBPD is upregulated in prostate tissue with a high postmortem interval, where it functions as a transcription factor indicative of active gene transcription even after death [Javan et al. DOI:10.1038/s41598-025-29561-7]. Separately, research in mice and humans identified the CEBPD as a novel disease gene that is upregulated in sepsis-induced myocardial dysfunction, with its differential expression validated by qRT-PCR and external datasets [Yao et al. DOI:10.1016/j.ygeno.2024.110911].