| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUACACGUCGGUUGCCUAACAACCGGCAGCGGACUCCUUUGGCUAU… | 1413 nt | 0.4105 |
Caltractin belongs to a family of calcium-binding proteins and is a structural component of the centrosome. The high level of conservation from algae to humans and its association with the centrosome suggested that caltractin plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the CETN2 gene was downregulated in lung tissue as part of the inhibited cilium assembly and cell cycle pathways in sepsis patients compared to uninfected controls [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].