| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUUUGUAUGGGCUGCAGCCUGCCGCUGAGCUGCAUCAUGGUGCGGUCU… | 2191 nt | 0.5568 | |
| GGUUUGUAUGGGCUGCAGCCUGCCGCUGAGCUGCAUCAUGGUGCGGUCU… | 2248 nt | 0.5560 |
Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
A study in humans demonstrated that the CHIT1 is a prognostic biomarker and potential therapeutic target for sepsis, with significantly higher expression in sepsis patients versus healthy controls and in non-survivors versus survivors, associated with 28-day mortality (HR 1.38) [Li et al. DOI:10.1038/s41598-025-99619-z]. A study in mice demonstrated that the murine homolog of the CHIT1, chitinase-like 3 (Chil3), is a potential histological marker for wound age estimation, with its protein expression peaking at 2 days post-injury and Chil3-positive neutrophils localized specifically in the scab and granulation tissue of 1–3-day-old wounds [Murase et al. DOI:10.1007/s00414-017-1658-7].