Basic Information

Symbol
CLCF1
RNA class
mRNA
Alias
Cardiotrophin Like Cytokine Factor 1 BSF-3 NNT-1 NNT1 BSF3 CLC Novel Neurotrophin-1 CISS2 NR6 CRLF1 Associated Cytokine-Like Factor 1 Cardiotrophin-Like Cytokine Factor 1 B-Cell-Stimulating Factor 3 Neurotrophin-1/B-Cell Stimulating Factor-3 Cold-Induced Sweating Syndrome 2 B-Cell Stimulating Factor 3 B-Cell Stimulatory Factor 3
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_013246.3
Sequence length
1705.0 nt
GC content
0.5795

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-676.50 kcal/mol
Thermodynamic ensemble
Free energy: -706.55 kcal/mol
Frequency: 0.0000
Diversity: 318.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((.(((((((..((((((((((..(((((.(((((((((((((((..((((((((..((((.....))))..))))))))........(((((....)))))((((.(((((((.........))))))).........)))).)))).))..))))).)))).......................((((((.(((...(((((......))))).)))..)).))))..((.((((........((((...((((....(((..((((((((((((((....(((((.(((((((...))))))).(((((((.((((((..(((((.(((((...(((((.........(((.((....)))))......))))).....))))))))))..))))...))))))))).....((((((((((...(((......)))..))))))))))...(((((((((((((((.((((((((((((((((((.(((.(((((...(((.((((...))))..))).))))))))..))))))((((......)))).(((((.((((((((..(((((((((.(......(((((((........)))))))((((..........))))...).))))))).))..)))).)))).)))))..((((((.........)).)))).....(((.(((((.....))))).)))(((((((((((((((((.((((((..............................((((((.(((...))).))).)))........((((((....)))).)))))))).))))))))))))))))).((.((......)).))(((((..(((.....)))..)))))...(((((((((((.(((.....((....))))).)))))))))))..)))))))))))).....((((((....))))))..((((((((....))))))))........))))))))))))))).((.(.(((((......................)))))).))(((((..((((.(((((((...))))))).)))).((((.((((((((.((..(((..((........((((((..((((....)))))))))).......))..)))..)).)).)))))).))))...............(((......))).........)))))((.((((........)))).)).......))).))))))))))))))))..))))))).)))).......))))..))..(((((((.(((((..(((((((((............((((......))))((...((.(((..(((..........)))..))).))....)).)))))))))....)).))).)))))))..)))))..))))))).))).....((((.((...)).)))).....))))))))))((((((.(((..........((((....)))).........(((((....))))).((((((...(((.(((((..((....))..))))))))..))))))...........(((((((((.((.(((....)))..)).)))))))))(((((((((...)))))))))(((.((((((((....)))).)))).)))........))).)))))).....
Thermodynamic Ensemble Prediction
......,(((.(((((((..(({(((((((..(((((.(((((((((((((((..((((((((..((((.....))))..}))))))),.,,..{,(((((,...}}}}){||{.{{{|||{}.....}.,)))))}),,.......}}}}.)))).))..))))).))))....,....{{........,,..{,{{,(,(((...(((((......))))).))}..)),))))..((.((((........((((.,.(({{{(({...(,{(((((((((((((....((((..(((((((...))))))).))))(((((((((({{(((((.(((((...(((((...,.....(((.((....)))))......))))).....)))))))))){,||....{{,(((((((({{{,((((((((((...{((......)))..)))))))))).....(((((((((((((.((((((((((((((,(((((((.(((({....((((((.((((((........)))))))..)))))){(((......)))}..,((,.{|{{||||..||||,||||}.}}.}}.{((((((........))))))|((((({..{{,{{{{{{,.{{{{||||,},.,,.}))))},)),{|||,....,.,...,..}..,.)))))))},}}}}}))(((((.....))))).|,((((((((((((((((((.((((((..............................{{((((.(((...))).)))),))........((((((....)))).)))))))).))))))))))))))))))((.((......)).))((((({.(((....,))).,)))))..,{((((((((((.(((.....{{....}}))).))))))))))},.))))))))))))..,,.((((((....)))))),,((((((((....))))))))........)))))))))))))(((((,..,((((...,{,.....,,.....,...))))))))))..{((.((((.(((((((...))))))).)))).}))))}}|}}))))))||((({.((((......((((((..((((....))))))))))...{{({{((((((((((...........................)))))),,)))))))......}}))))))||.,{{{.,.,....}}}}.,))).))))))))).))))))))))))))).))))))).)))).......)))),,,}..(((((((.((({(,,(((((((((...,....,.,,.,,,....}.)))}{{...((.(((..(((..........)))..))).)).,..)).)))))))))....))}))).)))))))..)))))..))))))).))}.....((((.({...)).)))).....))))))))))|(((((.(((..........((((....)))).........(((((....))))}.((((((...(((.(((((..((....))..))))))))..)))))).........,.{{{{{{{{|,||.{,,....,,,..,|,||||||}}|(((((((({...}))))))))|{{.((((((((....))))}}))).}},,,,,,,,.))).)))))}.....

Transcripts

ID Sequence Length GC content
ACUUGCUCCCAGGCCAGCUCGCUGGCAUUUGGGAGAAUGUGUCAUUGCA… 1761 nt 0.5707
CUCCCACUCCGCCAGCCUCCGGGAGAGGAGCCGCACCCGGCCGGCCCGG… 1705 nt 0.5795
Summary

This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]

Forensic Context

A study in mice demonstrated that the expression of the CLCF1 gene, associated with apoptosis, was significantly altered following chlorpromazine administration, with its expression gradually increasing from week 2 to 3 with repeated low-dose treatment before returning to baseline at week 4, indicating a time- and dose-dependent anti-apoptotic response in cardiomyocytes [Tsai et al. DOI:10.1016/J.Legalmed.2011.04.006]. A separate review of single-cell sequencing in mouse and human myocardial infarction models identified the CLCF1 protein as a mediator of cardiomyocyte-macrophage interaction, secreted by mononuclear macrophages to promote neonatal cardiomyocyte proliferation [Bian et al. DOI:10.3892/mmr.2025.13680].