| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUGCUCCCAGGCCAGCUCGCUGGCAUUUGGGAGAAUGUGUCAUUGCA… | 1761 nt | 0.5707 | |
| CUCCCACUCCGCCAGCCUCCGGGAGAGGAGCCGCACCCGGCCGGCCCGG… | 1705 nt | 0.5795 |
This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
A study in mice demonstrated that the expression of the CLCF1 gene, associated with apoptosis, was significantly altered following chlorpromazine administration, with its expression gradually increasing from week 2 to 3 with repeated low-dose treatment before returning to baseline at week 4, indicating a time- and dose-dependent anti-apoptotic response in cardiomyocytes [Tsai et al. DOI:10.1016/J.Legalmed.2011.04.006]. A separate review of single-cell sequencing in mouse and human myocardial infarction models identified the CLCF1 protein as a mediator of cardiomyocyte-macrophage interaction, secreted by mononuclear macrophages to promote neonatal cardiomyocyte proliferation [Bian et al. DOI:10.3892/mmr.2025.13680].