Basic Information

Symbol
DNAJA1
RNA class
mRNA
Alias
DnaJ Heat Shock Protein Family (Hsp40) Member A1 HSPF4 Hdj-2 NEDD7 Dj-2 HSJ2 Neural Precursor Cell Expressed, Developmentally Down-Regulated 7 DnaJ (Hsp40) Homolog, Subfamily A, Member 1 DnaJ Homolog Subfamily A Member 1 Heat Shock 40 KDa Protein 4 DnaJ Protein Homolog 2 Heat Shock Protein J2 Human DnaJ Protein 2 HSJ-2 HDJ2 HSDJ Heat Shock Protein, DNAJ-Like 2 DNAJ2 HDj-2 DjA1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001539.4
Sequence length
2319.0 nt
GC content
0.4084

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-626.50 kcal/mol
Thermodynamic ensemble
Free energy: -671.91 kcal/mol
Frequency: 0.0000
Diversity: 575.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((............((.(((((.((((((((((((((.........(((((((....)))).))))))))))..))))...)))...)))))))....(((......))).(((((((.((..........)).))).))))((((((((((((......)))..(((...(((((.((((((.....((((((...((((((((..((((((.(.(..((((.................))))..).).))))))))).))))).))))))....)))))).))))).))).........................(((((((.((.(((....(((((((.(((((.((........)).))))))))..((((((.......))))))...(((.(((((((..(((.(((((((...((((..(((.....((((((((..........(((...........))).........)))))))).....(((..((((((.......(((........))).........))))))..)))..(((.((.((((((((..(((.(((((...(((..((((((...(((((....(((............(((((......)))))...........)))...)))))..))))))..)))..))))))))(((....)))...........((((.(((((((((((((..........(((((((.(((...........((((((((........(((((((((((((((....((((((((...(((((((....(.((..(..(((....)))..)..)))....))))))).))))))..))....)).))))...((((((.(((...)))..)))))).)))))))))))))))))((((((..(......)..))))))(((((....)))))....))).)))))))........(((((.((((((..((((.((((((.(((.((((((.....(((((.....(((....)))..((((((((..(((..(((.(((((.....)))))))).))).))))..))))........(((........)))(((((.....)))))))))))))))).))).)))..........((((((.((.....)).))).)))))).)))).))))))))))).....((((...(((((..(.((..(((......)))..)).).)))))))))((((.(((.((((..((((.((((((((((((((.....)))))))))))...)))..)))).........((((((((..((((((((((((.(((.....))))))))))))....(((((((((((((....((((((..((.((((((((..((((((((..((((((((((.........))))......))))))..))))))))..))))........((.((((....(((..(((((((((..(((((((..........))))))).......((((.....))))..........((((((((((((((((....((.((((..((........))..)))).))....)))))))....)))))))))))))))))).))).)))).))......(((((((((((.........((.......)).........))))))))))).............)))).)).)))))).....))))))))))))).....)))..))))))))..)))).))).))))..)))))))))...)))).))))..((((.(((((((........(((((((((......))).)))))).(((((((((((((...))))))))..)))))..)))))))))))....(((...((((..........))))..))))))))))).)).)))((((((((((....)))))))))).......)))..))))..)).))))))))))))))).)))((((((.((((...(((((.((..((....))..)))))))((((..(((((((((.............(((.(..(((((((((((((((((((..((((....))))...)))))))).............((((..(((((((......)))))))...)))).)))).))))))).).)))....)))))))))...))))........))))..)))))).((((((((((((.....))).)))))))))..))))....)))..))))))))).............))))))))))))..
Thermodynamic Ensemble Prediction
..(((.....,,.{,..((.(((((,({((((((((((((.........(((((((....)))).))))))))))..))))...)))...})))))).,..(((......))).(((((((.((.,........)).))).))))((((((((((((,.....)))..,{(,..((((({,{,{{{....{(((((,..((,,..|||}}}}}..|,|.,,.})))}}..,,...{,......,)).(((((((({....))))))))).,}}}}....||||||{{||,,.}},.,....,}}}}}}|...,,......(((((({,((,(((.{{.(((((((.(((((.{{.......,)}.))))))))..{(((((....,..}))))}...(((.(((((((..(((.((((({,...((((..(((.....((((((((,,.{{,{{{.((.....}}.},,}})}.........)))))))).....(((..((((((.......(((........)))..,.,....))))))..)))..(((.((.((((((((..(((.(((({.,.(((..((((((...(((((....(((............(((((......)))))...........))),,.)))))..))))))..))).,))))))))((((({((((..,{{{{{{{{((,..,((({(({((({{,,,,..,.,{(({{({{.{{{...,,.,....(((({({(,,,,.,,.(((((({({(({(((....{.{,,((,{{{,((((,,.{,.,.||..,.}|||}},.))}..}..))).}}.}},)))}.))})),,.)),,..)),)}}}.,.||||||.{((,,.||||||}}},},)))))}}||||}}}}))|||||{|}}}}}}.,)}.}}}},|((((|....})))),}}})))},)))),,........(((((.((((((..((((.((((({.(((.((((((.....(((((.....{{{....,}}..((((((((..(((..{({.(((((.....)))))})}.))).))))..))))........(((........)))(((((.....)))))))))))))))).))).))...,,}},...{(((((.{(,....)).)))},))}}}.)))).))))))))))){(({.({,,..,|||||}}},,|}}|||.....,|||{{,|{{{|||||||,|,{|||{{.,((({,,((((.((((((((((((((.....))))))))))}..,)))..)))).....|{{,((((((((..((((((((((({{(((.....)))))))))))}....(((((((((((((....((((((.,((.((((((((..((((((((..(((((({{((,,....,,,}}}}......))))))..))))))))..)))).......,{{,.{.({{{{((({{(,{,((.,....||,|))}.}.}}}}}}){||||||,{{{,.{(({...,,|}|,..,.}}},..((((((((((((((((....((.((((..((........))..)))).))....))))))}...,)))))))))}}}},)))}})))}))}}}}},.....(((((((((({.{..,....((.......}}.,.,.,..,)))))))))))..,,......,,,)))).)}.)))))).....)))))))))))))....,)))..))))))))..||}}}}}},}}}}..,}}}|}||}..})}}}.}}}}.,|,||.||||||,........{((((((((......))).)))))}.(((((((((((((...)))))))}.,)))))..}))))),}}|||.{{(({...||,|,,,.,},,.,)),)}}))))))))))).)).))),(((((((((,...,))))))))),....,.)))..))))..)).))))))))))))))).)))((((((.{({{...((((,,((..((....))..))))))){(((..(((((((((.........,||.{{{,{..(((((((((((((((((((.{((({...,)))}...)))))))),{.....}}....((((..(((((((......))))))).,.)))).)))).))))))).}.}}},,..)))))))))...)))}........)))}..)))))).((((((((((((,...,)))},))))))))..)))).,}.))).,}))))))))..,..........))))))))))))..

Transcripts

ID Sequence Length GC content
GCGGAACUUUCCAGAACGCUCGGUGAGAGGCGGAGGAGCGGUAACUACC… 2141 nt 0.4059
GCGGAACUUUCCAGAACGCUCGGUGAGAGGCGGAGGAGCGGUAACUACC… 2319 nt 0.4084
Summary

This gene encodes a member of the DnaJ family of proteins, which act as heat shock protein 70 cochaperones. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. In humans, this gene has been implicated in positive regulation of virus replication through co-option by the influenza A virus. Several pseudogenes of this gene are found on other chromosomes. [provided by RefSeq, Sep 2015]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the DNAJA1 in cortical glial cells, with DNAJA1 being upregulated in microglia as part of the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649]. In human postmortem prefrontal cortex, transcriptional network analysis associated with lifetime alcohol consumption identified coordinated expression changes in molecular networks, though the specific forensic application of the DNAJA1 was not the focus of this investigation [Farris et al. DOI:10.1038/Mp.2014.159].