| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGGAACUUUCCAGAACGCUCGGUGAGAGGCGGAGGAGCGGUAACUACC… | 2141 nt | 0.4059 | |
| GCGGAACUUUCCAGAACGCUCGGUGAGAGGCGGAGGAGCGGUAACUACC… | 2319 nt | 0.4084 |
This gene encodes a member of the DnaJ family of proteins, which act as heat shock protein 70 cochaperones. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. In humans, this gene has been implicated in positive regulation of virus replication through co-option by the influenza A virus. Several pseudogenes of this gene are found on other chromosomes. [provided by RefSeq, Sep 2015]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the DNAJA1 in cortical glial cells, with DNAJA1 being upregulated in microglia as part of the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649]. In human postmortem prefrontal cortex, transcriptional network analysis associated with lifetime alcohol consumption identified coordinated expression changes in molecular networks, though the specific forensic application of the DNAJA1 was not the focus of this investigation [Farris et al. DOI:10.1038/Mp.2014.159].