| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCCUGGCUUCAGCUUCCAACUACAAAGACAGACUUGGUCCUUUUCAAC… | 2621 nt | 0.3899 | |
| GUCCUGGCUUCAGCUUCCAACUACAAAGACAGACUUGGUCCUUUUCAAC… | 2696 nt | 0.3884 |
The protein encoded by this gene is a homodimeric integral membrane gelatinase belonging to the serine protease family. It is selectively expressed in reactive stromal fibroblasts of epithelial cancers, granulation tissue of healing wounds, and malignant cells of bone and soft tissue sarcomas. This protein is thought to be involved in the control of fibroblast growth or epithelial-mesenchymal interactions during development, tissue repair, and epithelial carcinogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
A study in humans demonstrated that the FAP was significantly up-regulated in left ventricular myocardium from autopsy-defined arrhythmic sudden deaths compared to nonarrhythmic deaths, as part of a distinct transcriptomic profile related to the collagen-containing extracellular matrix and active fibrosis [Caudal et al. DOI:10.1016/j.jacep.2024.08.013]. This up-regulation, alongside other fibrosis-related genes, showed the highest magnitude of increased expression in arrhythmic cases and was associated with an acute vulnerable myocardial substrate for fatal arrhythmias, identifiable through postmortem RNA profiling.