| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUUCAGUGGCUUCUGGUGCUCUAGGGUGAGCUCUGCCCGGCUGCAGGG… | 762 nt | 0.5486 | |
| GUUUCAGUGGCUUCUGGUGCUCUAGGGUGAGCUCUGCCCGGCUGCAGGG… | 678 nt | 0.5546 |
This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the ATP6V1F gene, encoding a V-ATPase subunit, was up-regulated in serotonergic neurons of the ventral tegmental area during the addicting phase of nicotine self-administration [Fan et al. DOI:10.1016/J.Jgg.2024.08.009].